Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.137266 |
Chromosome: | chromosome 14 |
Location: | 330778 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g610050 | (1 of 1) K15180 - negative elongation factor B (COBRA1, NELFB) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGAAGGAGGTTGCGAGTTGTTGGCGCCA |
Internal bar code: | GGCACGTCGTCGTAATGTATAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 247 |
LEAP-Seq percent confirming: | 99.4887 |
LEAP-Seq n confirming: | 1362 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACTAAACCGAACCCAACGC |
Suggested primer 2: | ACGTTGAGGATCGGTGGTAG |