Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.137307 |
Chromosome: | chromosome 3 |
Location: | 7523967 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g205300 | EXN7 | (1 of 1) IPR000104//IPR002562//IPR012337 - Antifreeze protein, type I // 3'-5' exonuclease domain // Ribonuclease H-like domain; 3'-5' exonuclease | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCTGGCCACACGGTTTCACGGCGCATTG |
Internal bar code: | ATGGTATTACGATCGGGTAGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 210 |
LEAP-Seq percent confirming: | 92.6676 |
LEAP-Seq n confirming: | 2060 |
LEAP-Seq n nonconfirming: | 163 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCTAACGCTGATGCTGTC |
Suggested primer 2: | ACACACACACACGCACACAC |