Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.137337 |
Chromosome: | chromosome 9 |
Location: | 3705089 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g390912 | (1 of 54) IPR001680//IPR017986 - WD40 repeat // WD40-repeat-containing domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCAGAGACGGAGGCGGCGCTTCCACGCA |
Internal bar code: | GCGTGAATTGGACCACAGTCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 770 |
LEAP-Seq percent confirming: | 96.2441 |
LEAP-Seq n confirming: | 7995 |
LEAP-Seq n nonconfirming: | 312 |
LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCTGAACCGTACTCCCACC |
Suggested primer 2: | GTGTGATGTGGTGGAGCAAC |