| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.137406 |
| Chromosome: | chromosome 1 |
| Location: | 4663832 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g032150 | FAP187 | (1 of 2) PTHR22847//PTHR22847:SF442 - WD40 REPEAT PROTEIN // SUBFAMILY NOT NAMED; Flagellar Associated Protein 187 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCGACTCTCATAGATGCGCTGAGCGCAA |
| Internal bar code: | GGCGACCCTGAGTTTGTAAGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 365 |
| LEAP-Seq percent confirming: | 99.8977 |
| LEAP-Seq n confirming: | 5861 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCCAATAGAAAGACACGGC |
| Suggested primer 2: | GCAATCTATGCCACACCCTT |