| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.137472 |
| Chromosome: | chromosome 2 |
| Location: | 7224738 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g146000 | (1 of 1) K14798 - protein LTV1 (LTV1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATAGACGAGACTGGGCAGCACCTCACGGC |
| Internal bar code: | GTCTCACCCCCGACAGGGATGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 860 |
| LEAP-Seq percent confirming: | 97.4282 |
| LEAP-Seq n confirming: | 5872 |
| LEAP-Seq n nonconfirming: | 155 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAAATGGTGCTGGTATCCT |
| Suggested primer 2: | CTTCCCAACGCACCTTGTAT |