Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.137485 |
Chromosome: | chromosome 13 |
Location: | 2014447 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g576760 | ELI6,ELIP6 | Early light-induced LHC-like protein; (1 of 6) PTHR14154:SF5 - EARLY LIGHT-INDUCED PROTEIN 1, CHLOROPLASTIC-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACCCAGTCGCAACTCAAATCGCCCGCCT |
Internal bar code: | CCTGGTATTGCTCGCATAACGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 468 |
LEAP-Seq percent confirming: | 99.691 |
LEAP-Seq n confirming: | 4194 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGGAGAGCTTCAGGGTGAG |
Suggested primer 2: | AGGTGTGGGTGAAGGTGAAG |