| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.137491 |
| Chromosome: | chromosome 9 |
| Location: | 103739 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g386550 | (1 of 1) K12492 - ADP-ribosylation factor GTPase-activating protein 1 (ARFGAP1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCTCCCCAGCCGGCCGCGCTCACACCTG |
| Internal bar code: | CAGATAGTTGTTCAGGGAGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1191 |
| LEAP-Seq percent confirming: | 99.4615 |
| LEAP-Seq n confirming: | 51348 |
| LEAP-Seq n nonconfirming: | 278 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGAAGCAATGCAGTCAGA |
| Suggested primer 2: | CTACCACTTGCCCCACTCAT |