| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.137500 |
| Chromosome: | chromosome_17 |
| Location: | 3896938 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre17.g728300 | FAP226,CAL6 | Calpain cysteine protease and Flagellar Associated Protein | sense | intron |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | GGCACCAAAACGTACTCCAGCAGCGCTAGC |
| Internal bar code: | GCGGGTCGCCATCGTCCGGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 664 |
| LEAP-Seq percent confirming: | 96.6863 |
| LEAP-Seq n confirming: | 2626 |
| LEAP-Seq n nonconfirming: | 90 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATCATGTGGGCACCTAAA |
| Suggested primer 2: | CTTGGTAATGGAGTTGCCGT |