Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.137682 |
Chromosome: | chromosome 16 |
Location: | 2935299 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g664050 | (1 of 1) PF02893//PF16016 - GRAM domain (GRAM) // Domain of unknown function (DUF4782) (DUF4782) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCATTTGCGTCGTCATACTACGCCCACG |
Internal bar code: | TTAGTTCCCTCGTTGCCAAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 945 |
LEAP-Seq percent confirming: | 99.5651 |
LEAP-Seq n confirming: | 23124 |
LEAP-Seq n nonconfirming: | 101 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGGTGTGTCTGTGTGGTG |
Suggested primer 2: | TCTGAGCCTAGGAGGCGTAA |