Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.137701 |
Chromosome: | chromosome 7 |
Location: | 2639460 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g330500 | (1 of 5) PF04232 - Stage V sporulation protein S (SpoVS) (SpoVS) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCACCTGCGTGTGAGGCCATGAGCAAGC |
Internal bar code: | CATGATTAGTGTATCACCTAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 903 |
LEAP-Seq percent confirming: | 99.439 |
LEAP-Seq n confirming: | 15599 |
LEAP-Seq n nonconfirming: | 88 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGGATTGCAGTGACAAGAT |
Suggested primer 2: | GGGGATTGATAGAGGTGCAA |