| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.137729 |
| Chromosome: | chromosome 13 |
| Location: | 2491200 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g580150 | SAMT1,MOT2A | Molybdate transporter, type 2. Member 1; (1 of 2) PTHR23516:SF1 - MOLYBDATE-ANION TRANSPORTER | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAACTGCGGTTAACAAAATCACCAACAT |
| Internal bar code: | AGGAGGGGATTCCCGTGGTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 793 |
| LEAP-Seq percent confirming: | 99.2022 |
| LEAP-Seq n confirming: | 4974 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCATTTTGACCCCACTAGC |
| Suggested primer 2: | GATTTGCATTCTGCAAGGGT |