Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.137768 |
Chromosome: | chromosome 6 |
Location: | 2542108 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g269200 | CYA7 | (1 of 2) 2.7.11.1//4.6.1.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Adenylate cyclase / ATP pyrophosphate-lyase; Adenylate cyclase | intron|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATCCCCCGCCCCTGTCCGGCTGCAGTCG |
Internal bar code: | AGTGGGGTATGATACCGACAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 84 |
LEAP-Seq percent confirming: | 99.4518 |
LEAP-Seq n confirming: | 907 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCTCTCCTCTCCTCTTCCC |
Suggested primer 2: | TGTGTGTGTGTGTGTGGACC |