| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.137804 |
| Chromosome: | chromosome 17 |
| Location: | 452511 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g699000 | PAT1 | Phosphate acetyltransferase; (1 of 2) 2.3.1.8 - Phosphate acetyltransferase / Phosphotransacetylase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGCTTAACAACATGAATGATCCCTACAC |
| Internal bar code: | GTGCAGGCAGGGAGGCGGAGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1036 |
| LEAP-Seq percent confirming: | 98.6954 |
| LEAP-Seq n confirming: | 1513 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTTTGCGCTTTGTTTTCCT |
| Suggested primer 2: | TGATACGAAACCTTCTGCCC |