| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.137839 |
| Chromosome: | chromosome 13 |
| Location: | 2392111 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g579550 | CGL27 | Conserved in the Green Lineage; (1 of 5) IPR002645 - STAS domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGCTTGCTTAAACCAAGCGACGGCCCCG |
| Internal bar code: | CGTCGCATTCGAGTTACCGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 768 |
| LEAP-Seq percent confirming: | 99.857 |
| LEAP-Seq n confirming: | 5585 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGCCTTCTAAAATCGACG |
| Suggested primer 2: | GGTCACAGTCACCCTCCTGT |