| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.137844 |
| Chromosome: | chromosome 12 |
| Location: | 2188445 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g508450 | (1 of 1) IPR001680//IPR002893//IPR017986 - WD40 repeat // Zinc finger, MYND-type // WD40-repeat-containing domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGATGTGGGGCGGGATCTGTTGTGGGGAG |
| Internal bar code: | GGCGATTCCTATTCGGGGACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 849 |
| LEAP-Seq percent confirming: | 98.3819 |
| LEAP-Seq n confirming: | 1824 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCCTTTTTACCCCAACCC |
| Suggested primer 2: | GAAGGCGGTGTGTGTGTATG |