| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.137904 |
| Chromosome: | chromosome 6 |
| Location: | 21290 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g248800 | (1 of 1) PTHR31109:SF2 - PROTEIN FAM207A | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATCGCGGCGGCTTTTTGTGGTCAACGTT |
| Internal bar code: | ATATCTGTGTGGATTGACTGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 171 |
| LEAP-Seq percent confirming: | 65.9339 |
| LEAP-Seq n confirming: | 4109 |
| LEAP-Seq n nonconfirming: | 2123 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTGTACGCTGAGGGATGT |
| Suggested primer 2: | TCCAACTCCAAAGAGCCAAC |