| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.137956 |
| Chromosome: | chromosome 3 |
| Location: | 3714745 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g169500 | FLS2 | (1 of 18) K08824 - cyclin-dependent kinase-like [EC:2.7.11.22] (CDKL); Flagellar shortening 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGGCTGTTACGTTCGCGGGCTGGGCTGG |
| Internal bar code: | CGAAGTTGAGCGCTTGTGGATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 871 |
| LEAP-Seq percent confirming: | 99.0466 |
| LEAP-Seq n confirming: | 6545 |
| LEAP-Seq n nonconfirming: | 63 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATTCGTCGTTGGCTTTTTG |
| Suggested primer 2: | CGTCCCATACATAAAACCCG |