Insertion junction: LMJ.RY0402.138054_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.138054
Chromosome:chromosome_16
Location:7720660
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre16.g691440 FAP43 Flagellar Associated Protein sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):AAGGTGGAGCTGTTGACGGCCATGAAGGAC
Internal bar code:CGGTAGAGGCCAGGCAGAGCTT

Confirmation - LEAP-Seq

LEAP-Seq distance:927
LEAP-Seq percent confirming:98.132
LEAP-Seq n confirming:13659
LEAP-Seq n nonconfirming:260
LEAP-Seq n unique pos:62

Suggested primers for confirmation by PCR

Suggested primer 1:CTTCAAAAAGGAGTTTGCGG
Suggested primer 2:ACAGCCTTGGACCTTCCTTT