| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.138070 |
| Chromosome: | chromosome 16 |
| Location: | 4854517 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g686050 | (1 of 1) PF05277 - Protein of unknown function (DUF726) (DUF726) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGACACAAGGAATGGGGAGGAGGAGGGGG |
| Internal bar code: | CGAACAATCCTCCGGGCAGCTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 415 |
| LEAP-Seq percent confirming: | 99.4732 |
| LEAP-Seq n confirming: | 5287 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCACATCTATACACACGCC |
| Suggested primer 2: | GAGAGGCGGGTATTGTGTGT |