| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.138174 |
| Chromosome: | chromosome 3 |
| Location: | 7999080 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g201700 | (1 of 1) PF15072 - Domain of unknown function (DUF4539) (DUF4539) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGCCCTGCCGCCGGGGCCGCAGCCACA |
| Internal bar code: | GTGCTCCCCCGGAGTCGGACTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 573 |
| LEAP-Seq percent confirming: | 76.934 |
| LEAP-Seq n confirming: | 4346 |
| LEAP-Seq n nonconfirming: | 1303 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGAAAGCACTGCCTATGTT |
| Suggested primer 2: | CAGCAACAGCTCCAAGTGAG |