| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.138211 |
| Chromosome: | chromosome 7 |
| Location: | 904458 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g318900 | DNJ2 | (1 of 1) PF00226//PF13637 - DnaJ domain (DnaJ) // Ankyrin repeats (many copies) (Ank_4); DnaJ-like protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCTGCGCGCAGCACGCACATGCCAGCGG |
| Internal bar code: | CGGATCGGTGTCCCGTGGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 421 |
| LEAP-Seq percent confirming: | 99.1836 |
| LEAP-Seq n confirming: | 6682 |
| LEAP-Seq n nonconfirming: | 55 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTGTCCTGCACGTATTGC |
| Suggested primer 2: | CGCTTGTGAAGGAGTGGATT |