| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.138240 |
| Chromosome: | chromosome 10 |
| Location: | 3905291 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g447900 | (1 of 1) PF12239 - Protein of unknown function (DUF3605) (DUF3605) | 3'UTR|3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCAGAATGCGCGCGCGCAAGCAGCTGCC |
| Internal bar code: | GGGTGAGATTTTTGGGATAGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 986 |
| LEAP-Seq percent confirming: | 99.1665 |
| LEAP-Seq n confirming: | 20702 |
| LEAP-Seq n nonconfirming: | 174 |
| LEAP-Seq n unique pos: | 108 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCACATGTGATGGTTAAGG |
| Suggested primer 2: | GTCCGACCCAAATAGGGATT |