| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.138265 |
| Chromosome: | chromosome 1 |
| Location: | 4058919 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g026500 | ASP3 | (1 of 2) 3.4.23.12 - Nepenthesin / Nepenthes aspartic proteinase; Pepsin-type aspartyl protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTACCGTATTGTGCTTGGACGCAGGGAA |
| Internal bar code: | GTGCGAGCGGGGGCCGTAACAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 778 |
| LEAP-Seq percent confirming: | 99.9137 |
| LEAP-Seq n confirming: | 5792 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTTGCACCACAGACTGGC |
| Suggested primer 2: | GAGGTAGGCCCCTTCTATGG |