| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.138275 |
| Chromosome: | chromosome 14 |
| Location: | 3935082 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g632950 | NOT1 | (1 of 1) K12604 - CCR4-NOT transcription complex subunit 1 (CNOT1, NOT1); Component of CCR4-NOT transcriptional regulator complex | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGGTTACCTACTGTGCGCCTGTGGTGTG |
| Internal bar code: | AAATCCGCGAGTGACACGCCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 836 |
| LEAP-Seq percent confirming: | 79.5931 |
| LEAP-Seq n confirming: | 2582 |
| LEAP-Seq n nonconfirming: | 662 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTCCGAGAATGGTGGTGT |
| Suggested primer 2: | AAGTGGTAATGCGGGTTGAG |