| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.138307 |
| Chromosome: | chromosome 1 |
| Location: | 8025514 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g071662 | ACS1 | Acetyl-CoA synthetase/ligase; (1 of 3) K01895 - acetyl-CoA synthetase (ACSS, acs) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAGCCGCAGCCGGACGCAGCACAGTTGT |
| Internal bar code: | CGTGCGTGGAGCCAGTGAAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 721 |
| LEAP-Seq percent confirming: | 48.3452 |
| LEAP-Seq n confirming: | 2644 |
| LEAP-Seq n nonconfirming: | 2825 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTAAACGCCCCTCTAAAC |
| Suggested primer 2: | CGGATGCAAGCAGATGTCTA |