| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.138336 |
| Chromosome: | chromosome 5 |
| Location: | 2234203 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234659 | MRPL30,uL30m | (1 of 1) K02907 - large subunit ribosomal protein L30 (RP-L30, MRPL30, rpmD); Mitochondrial ribosomal protein L30 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCATACCGTGGCACATCCTGCCATCATG |
| Internal bar code: | GTGAGTTGCAAGATTTAAGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 757 |
| LEAP-Seq percent confirming: | 99.736 |
| LEAP-Seq n confirming: | 4912 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGACAAGTCAGCAGGTGGA |
| Suggested primer 2: | TGGGTTTCCAAGGAGAACAG |