Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.138345 |
Chromosome: | chromosome 1 |
Location: | 2439925 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g013650 | (1 of 3) PF15612 - WSTF, HB1, Itc1p, MBD9 motif 1 (WHIM1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAGCGTACTCGAGGGTTTGCCATCGACC |
Internal bar code: | TGCTCTTGATTGCAACACCTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 728 |
LEAP-Seq percent confirming: | 99.7 |
LEAP-Seq n confirming: | 7975 |
LEAP-Seq n nonconfirming: | 24 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCACCAACTACTCAAAGCA |
Suggested primer 2: | ACGGTTATGCCCAGTGAGAC |