| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.138458 |
| Chromosome: | chromosome 11 |
| Location: | 2829832 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g477500 | (1 of 1) PF13664 - Domain of unknown function (DUF4149) (DUF4149) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCCATAGCTGAGACTTCCACGCACCCCA |
| Internal bar code: | CGTAGGCCTGCATCGGCATCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 968 |
| LEAP-Seq percent confirming: | 95.9166 |
| LEAP-Seq n confirming: | 3265 |
| LEAP-Seq n nonconfirming: | 139 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCATACATGAGCACGTCAC |
| Suggested primer 2: | AAACATAGGTTTTGGCGACG |