| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.138518 |
| Chromosome: | chromosome 6 |
| Location: | 1051513 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g256420 | (1 of 1) K15196 - transcription factor IIIB 90 kDa subunit (BRF1, GTF3B) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCACCTGCTGAACTGCTGGAACTGTGGA |
| Internal bar code: | CACAGGGTCTTTGCGTTTTTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 866 |
| LEAP-Seq percent confirming: | 99.7229 |
| LEAP-Seq n confirming: | 3599 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGATCAACTACGGAGCCC |
| Suggested primer 2: | CGGACAGGAATGAAGCAAAT |