| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.138675 |
| Chromosome: | chromosome 17 |
| Location: | 246604 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g697950 | AAA3 | Plastidic ADP/ATP translocase; (1 of 2) PTHR31187:SF1 - ADP,ATP CARRIER PROTEIN 1, CHLOROPLASTIC-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCCCCTTGCGCCCATCCACCCCACCCCA |
| Internal bar code: | GCTCCGGAGGGTACAGATCGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 376 |
| LEAP-Seq percent confirming: | 99.2857 |
| LEAP-Seq n confirming: | 139 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCCTCGGGATCTTTTCTC |
| Suggested primer 2: | TACTTCGGTTGGGTACGAGG |