| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.138676 |
| Chromosome: | chromosome 13 |
| Location: | 1788003 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g574900 | FAP228,GTR2,GSL5 | Flagellar Associated Protein 228; (1 of 4) K00706 - 1,3-beta-glucan synthase (E2.4.1.34) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCCTTCGCCATGAAGGTTCCCTTCGACT |
| Internal bar code: | CTCTATTGAAAGGTTGGGGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 451 |
| LEAP-Seq percent confirming: | 98.922 |
| LEAP-Seq n confirming: | 1560 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCACCTTCTTCTGCTTGC |
| Suggested primer 2: | GCAACACGCTTGGTGTCTAA |