Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.138721 |
Chromosome: | chromosome 17 |
Location: | 7091735 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g747247 | FAP2 | TPR-domain Flagellar Associated Protein 2; (1 of 1) IPR002151//IPR003593//IPR013026//IPR019734//IPR027417 - Kinesin light chain // AAA+ ATPase domain // Tetratricopeptide repeat-containing domain // Tetratricopeptide repeat // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTTCCATTCGTGGTTGTTTGAGGGGGAT |
Internal bar code: | TTGACCGCTGGGGCGAGGTCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 145 |
LEAP-Seq percent confirming: | 99.6674 |
LEAP-Seq n confirming: | 6593 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTAGGGTGGATTGGAGGTGA |
Suggested primer 2: | ACATTGCGAGCAAGACAGTG |