Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.138740 |
Chromosome: | chromosome 1 |
Location: | 6486106 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g046237 | GEX33 | (1 of 1) PTHR10799:SF777 - DNA-BINDING PROTEIN-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGAAGGAAACACGCGGGCTAACGTGTGTA |
Internal bar code: | GGGTCGTCTAGTGACTGACTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 192 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 325 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACAATTCGGTTTGTCGTG |
Suggested primer 2: | GCTGCTGCCTTCTGCTACTT |