| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.138790 |
| Chromosome: | chromosome 3 |
| Location: | 3247186 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g165700 | PDC3 | (1 of 1) 4.1.1.1 - Pyruvate decarboxylase / Pyruvic decarboxylase; Pyruvate decarboxylase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGGTAGTCCCAGTTCTTGATCACGTTGT |
| Internal bar code: | CGCGGGCCTGGCGTTATAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 350 |
| LEAP-Seq percent confirming: | 95.8578 |
| LEAP-Seq n confirming: | 3101 |
| LEAP-Seq n nonconfirming: | 134 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACCGAACAAACAATGACG |
| Suggested primer 2: | ATCTCCATAACCACCACCCA |