Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.138813 |
Chromosome: | chromosome 6 |
Location: | 7864565 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g303100 | (1 of 7) 2.7.11.1//2.7.11.17 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Calcium/calmodulin-dependent protein kinase / Microtubule-associated protein 2 kinase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCCCTAGCTGACGTTGCGCTCTGCACTG |
Internal bar code: | CTTTCGGCCGGGATGGTTTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 971 |
LEAP-Seq percent confirming: | 99.2367 |
LEAP-Seq n confirming: | 12351 |
LEAP-Seq n nonconfirming: | 95 |
LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAGAAAACGGGGAGAAAAC |
Suggested primer 2: | GACACACCCACACGATCAAG |