| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.138817 |
| Chromosome: | chromosome 2 |
| Location: | 6173265 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g113700 | (1 of 1) PF02151//PF08755 - UvrB/uvrC motif (UVR) // Hemimethylated DNA-binding protein YccV like (YccV-like) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCGGTGGGCCAGGGGTACCGGGTCAAA |
| Internal bar code: | CAGCGACCCCCCTAACGTCACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 781 |
| LEAP-Seq percent confirming: | 91.3664 |
| LEAP-Seq n confirming: | 10371 |
| LEAP-Seq n nonconfirming: | 980 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGTTGTGTGCAATGGAAG |
| Suggested primer 2: | CATCATCAACACGGTAACGC |