| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.138831 |
| Chromosome: | chromosome 1 |
| Location: | 102282 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g000700 | ZFR1 | (1 of 2) PTHR14155//PTHR14155:SF170 - RING FINGER DOMAIN-CONTAINING // SUBFAMILY NOT NAMED; zinc finger protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGCACGCACTCACCACACCTCCCCCACC |
| Internal bar code: | CTAGGTGGCCGACCAAAAGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 460 |
| LEAP-Seq percent confirming: | 97.4359 |
| LEAP-Seq n confirming: | 38 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACCACG |
| Suggested primer 2: | TACACTCCACTCCACTCCCC |