Insertion junction: LMJ.RY0402.138908_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.138908
Chromosome:chromosome_6
Location:1198474
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g257600 FA1 Flagellar Autonomy Protein sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GGCCCACTCACATTGCCGCCGCAGTTGGAA
Internal bar code:ATACTGTCCCAGACGTAAATAT

Confirmation - LEAP-Seq

LEAP-Seq distance:254
LEAP-Seq percent confirming:98.7234
LEAP-Seq n confirming:696
LEAP-Seq n nonconfirming:9
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:GATCTGGCTGCTGTGTTTGA
Suggested primer 2:CTGCCATATGACACTGGTGC