| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.138967 |
| Chromosome: | scaffold 19 |
| Location: | 201124 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre19.g751247 | (1 of 1) K16742 - ADP-ribosylation factor-like protein 2-binding protein (ARL2BP, BART) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGATGAGGGGCCGGGATCAGCGGCGGGGGC |
| Internal bar code: | GCCGACGACAAGGGTCGACCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 140 |
| LEAP-Seq percent confirming: | 9.55588 |
| LEAP-Seq n confirming: | 1121 |
| LEAP-Seq n nonconfirming: | 10610 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTGACGAGGAGTTTGAGG |
| Suggested primer 2: | ATGAACAGCTAGCCCCCTCT |