| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.138975 |
| Chromosome: | chromosome 12 |
| Location: | 7434871 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g556600 | GAP4,GAPN1 | (1 of 1) 1.2.1.9 - Glyceraldehyde-3-phosphate dehydrogenase (NADP(+)) / Triosephosphate dehydrogenase; Glyceraldehyde 3-phosphate dehydrogenase, nonphosphorylating | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCACCCGCGCGGCCTTTGCCTCAATGGT |
| Internal bar code: | TTGTGGTTTTACGCGGGTACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 797 |
| LEAP-Seq percent confirming: | 99.5291 |
| LEAP-Seq n confirming: | 54534 |
| LEAP-Seq n nonconfirming: | 258 |
| LEAP-Seq n unique pos: | 267 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCATTCACTCCCTCTGTT |
| Suggested primer 2: | GTTCGTGCTGTTCGGGTAAT |