| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.138986 |
| Chromosome: | chromosome 5 |
| Location: | 848297 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g247851 | CEP2 | Cysteine endopeptidase; (1 of 2) 3.4.22.14 - Actinidain / Actinidin | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCTGCCGCACGCCCAGTCACGCCCCGT |
| Internal bar code: | AGCTACCGGACTATGCGCTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 815 |
| LEAP-Seq percent confirming: | 99.1601 |
| LEAP-Seq n confirming: | 9091 |
| LEAP-Seq n nonconfirming: | 77 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTTTCCTCTTCACCCCTT |
| Suggested primer 2: | AGTGAAGCGGTTGGAAGAGA |