| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.139022 |
| Chromosome: | chromosome 8 |
| Location: | 3536927 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g375350 | SDR12 | (1 of 2) K19329 - WW domain-containing oxidoreductase (WWOX); Short-chain dehydrogenase/reductase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGAGACAACTGTTCGTCGGGGTGGAACG |
| Internal bar code: | CCTTTTTCTGCTCCGGGTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 797 |
| LEAP-Seq percent confirming: | 99.3651 |
| LEAP-Seq n confirming: | 2191 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGGTTTTATGCTGTCAGGT |
| Suggested primer 2: | GCGTAGAGACACACACGCAT |