| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.139044 |
| Chromosome: | chromosome 12 |
| Location: | 1957737 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g510400 | RBD4,CPLD30 | Conserved in the Plant Lineage and Diatoms; (1 of 4) IPR024934 - Rubredoxin-like domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGGGCCTTCCCGGACCGGCAAGGGATGT |
| Internal bar code: | AGGTTTCTTTGGAAACTTCCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1004 |
| LEAP-Seq percent confirming: | 87.6823 |
| LEAP-Seq n confirming: | 1082 |
| LEAP-Seq n nonconfirming: | 152 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAAAACGGGTGCATACTT |
| Suggested primer 2: | TGCTAAGCAAATTGGCAGTG |