Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.139082 |
Chromosome: | chromosome 12 |
Location: | 7244617 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g558250 | SNR7,TML1 | Regulatory R-SNARE protein, Tomsyn/Sro family (R.Reg); (1 of 1) PTHR10241 - LETHAL 2 GIANT LARVAE PROTEIN | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGACGACGAGGATGAGGAAGAGGCGGCG |
Internal bar code: | CGGCAACCTCGCGGACGGCACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 31 |
LEAP-Seq percent confirming: | 1.09827 |
LEAP-Seq n confirming: | 19 |
LEAP-Seq n nonconfirming: | 1711 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATAGTACGGCAAGGGCTGG |
Suggested primer 2: | CTTCCCTGATCCATTGTGCT |