| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.139108 |
| Chromosome: | chromosome 5 |
| Location: | 1961335 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g241638 | (1 of 1) IPR000253//IPR002562//IPR012337 - Forkhead-associated (FHA) domain // 3'-5' exonuclease domain // Ribonuclease H-like domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGGTTGCGGGATTTGGAGTCGCCTCCGT |
| Internal bar code: | GGGTTGGCTTGTGGCTTAAGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 790 |
| LEAP-Seq percent confirming: | 98.7259 |
| LEAP-Seq n confirming: | 3487 |
| LEAP-Seq n nonconfirming: | 45 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGCTGACATCGTTCAAGT |
| Suggested primer 2: | GTCTCTGTCTGCGGTCTTCC |