| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.139125 |
| Chromosome: | chromosome 12 |
| Location: | 5471009 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g530750 | (1 of 239) IPR016024 - Armadillo-type fold | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTGGGTGCCGCTGTCGGCGGGACGCGG |
| Internal bar code: | TAATCGCTTTGGTGATATGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 442 |
| LEAP-Seq percent confirming: | 98.8154 |
| LEAP-Seq n confirming: | 5589 |
| LEAP-Seq n nonconfirming: | 67 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCCCCTCTCATCCTCTATC |
| Suggested primer 2: | ACACAAGCAGTTACGCCCTT |