| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.139159 |
| Chromosome: | chromosome 12 |
| Location: | 7279354 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g557750 | DGTT1 | Diacylglycerol O-acyltransferase, Type 2; (1 of 2) PTHR12317:SF0 - DIACYLGLYCEROL O-ACYLTRANSFERASE 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTAGATGCCAGCTCTAACCAGCTATACTA |
| Internal bar code: | CGGTGACGGTGCATCCGCGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 892 |
| LEAP-Seq percent confirming: | 97.6806 |
| LEAP-Seq n confirming: | 4759 |
| LEAP-Seq n nonconfirming: | 113 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAAGTACGGCAAGGGTGTC |
| Suggested primer 2: | CCAACCTGTTTGAGGACGAT |