Insertion junction: LMJ.RY0402.139204_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.139204
Chromosome:chromosome_4
Location:1931500
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre04.g218250 ARL3 ARF-like GTPase antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CTAAATGGAAACTTTGTTCGGACATTTAAC
Internal bar code:CCTCACGGTTCACGACGTTCGG

Confirmation - LEAP-Seq

LEAP-Seq distance:1001
LEAP-Seq percent confirming:99.1944
LEAP-Seq n confirming:8988
LEAP-Seq n nonconfirming:73
LEAP-Seq n unique pos:14

Suggested primers for confirmation by PCR

Suggested primer 1:ATGCCTAAACGTTGGTCCAG
Suggested primer 2:GGCAGCTCCAAAGTGCTTAC