| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.139204 |
| Chromosome: | chromosome 4 |
| Location: | 1931520 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g218250 | FAP313,ARL3 | Flagellar Associated Protein 313; (1 of 1) K07944 - ADP-ribosylation factor-like protein 3 (ARL3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGTAGCTGCACCACGCCTCACACATGAA |
| Internal bar code: | TATGGTAATGGGATACGGTTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 260 |
| LEAP-Seq percent confirming: | 95.4598 |
| LEAP-Seq n confirming: | 2481 |
| LEAP-Seq n nonconfirming: | 118 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGATGATGAAGCAGGTCAA |
| Suggested primer 2: | ATGCCTAAACGTTGGTCCAG |