Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.139261 |
Chromosome: | chromosome 16 |
Location: | 5765078 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g678551 | CYG34 | (1 of 70) 4.6.1.2 - Guanylate cyclase / Guanylyl cyclase; Adenylate/guanylate cyclase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTACTGTCAACCAGATGAGATCCAATGG |
Internal bar code: | TGTGGTAGAGTGACTAGCTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 972 |
LEAP-Seq percent confirming: | 99.0912 |
LEAP-Seq n confirming: | 13412 |
LEAP-Seq n nonconfirming: | 123 |
LEAP-Seq n unique pos: | 79 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCTTGGTGTAAGCGTCGTG |
Suggested primer 2: | TTATGATTACAGCGCCCTCC |